Showing posts with label DNA sequence. Show all posts
Showing posts with label DNA sequence. Show all posts

What is VNTR (Variable Number Tandem Repeats)




VNTR (Variable Number Tandem Repeats)
 


-Sequences that are repeated multiple times vary from person to person

-The full genetic profiles of any two individuals (other than identical twins) reveal many differences

-Since most of the human genes are the same from one person to the other, DNA typing relies on the stretches of DNA that tend to differ among different people.

-While the repeated sequences themselves are usually the same from person to person, the number of times they are repeated tends to vary.

-These stretches of repeats, known as VNTR can be isolated from an individual’s DNA

AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA

-VNTR usually occurs in introns (non coding sequences)

-Repeat sequences are called Satellite DNA; it is of two types:

a. Minisatellite (VNTR) = 0.1 to 20kb
b. Microsatellite (STR) =short tandem repeats

Note: Tandem means repeat continuously without any break


DNA Fingerprinting Using VNTR’s:

-On some human chromosomes, a short sequence of DNA has been repeated a number of times.

-The repeated number may vary from 10-30 repeats. 

-The same repeat regions are usually bounded by specific restriction enzyme sites
.
-Cut the sequence of the chromosome bounded by specific restriction enzyme sites.

-Identify the VNTR’s for the DNA sequence of the repeat

Steps of DNA Fingerprinting

1.       Isolation of DNA
2.       Cutting, sizing and sorting – special enzyme called R.E are used to cut DNA at specific places. Electrophoresis is used to separate DNA fragments of individuals
3.       Transfer of DNA to Nylon – the distribution of DNA pieces is transferred to a nylon sheet by placing the sheet on the agar gel containing DNA fragments
4.       Probing – Adding radioactive or colored probes to the nylon sheet produces pattern called DNA fingerprints
 

Share:

Transcribe a Coding Sequence into mRNA

Suppose you are given a DNA sequence (considered to be a coding sequence). What would be the mRNA sequence of the same?

The Coding Sequence in question is given as 5--ATGCATGCATGCATGC---3

The Double helix DNA strand contains both coding as well as non-coding sequence. The non-coding sequence is also called as template sequence that takes part in transcription. However, the transcribed sequence will look like the coding sequence with only one difference - T will be replaced by U

So, the transcribed sequence will be:

5--AUGCAUGCAUGCAUGC--3




Share: