VNTR
(Variable Number Tandem Repeats)
-Sequences
that are repeated multiple times vary from person to person
-The
full genetic profiles of any two individuals (other than identical twins)
reveal many differences
-Since
most of the human genes are the same from one person to the other, DNA typing
relies on the stretches of DNA that tend to differ among different people.
-While
the repeated sequences themselves are usually the same from person to person,
the number of times they are repeated tends to vary.
-These
stretches of repeats, known as VNTR can be isolated from an individual’s DNA
AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA
-VNTR
usually occurs in introns (non coding sequences)
-Repeat
sequences are called Satellite DNA; it is of two types:
a.
Minisatellite (VNTR) = 0.1 to 20kb
b.
Microsatellite (STR) =short tandem repeats
Note:
Tandem means repeat continuously without any break
DNA
Fingerprinting Using VNTR’s:
-On
some human chromosomes, a short sequence of DNA has been repeated a number of
times.
-The
repeated number may vary from 10-30 repeats.
-The
same repeat regions are usually bounded by specific restriction enzyme sites
.
-Cut
the sequence of the chromosome bounded by specific restriction enzyme sites.
-Identify
the VNTR’s for the DNA sequence of the repeat
Steps of DNA Fingerprinting
1.
Isolation of DNA
2.
Cutting, sizing and sorting – special enzyme called R.E are
used to cut DNA at specific places. Electrophoresis is used to separate DNA
fragments of individuals
3.
Transfer of DNA to Nylon – the distribution of DNA pieces is
transferred to a nylon sheet by placing the sheet on the agar gel containing
DNA fragments
4.
Probing – Adding radioactive or colored probes to the nylon
sheet produces pattern called DNA fingerprints
No comments:
Post a Comment